Lancet 2002, 360:505–515.CrossRef 6. Ozols RF, Bundy BN, Greer BE, Fowler JM, Clarke-Pearson D, Burger RA, et al.: Phase III

trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a gynecologic oncology group study. J Clin Oncol 2003, 21:3194–3200.PubMedCrossRef 7. Young RC: Early-stage ovarian cancer: to treat https://www.selleckchem.com/products/carfilzomib-pr-171.html or not to treat. J Natl Cancer Inst 2003, 95:94–95.PubMedCrossRef 8. Holschneider CH, Berek JS: Ovarian cancer: epidemiology, biology, and prognostic factors. Semin Surg Oncol 2000, 19:3–10.PubMedCrossRef 9. McGuire WP, Brady MF, Ozols RF: The gynecologic oncology group experience in ovarian cancer. Ann Oncol 1999,10(Suppl 1):29–34.PubMedCrossRef 10. McGuire

WP, Hoskins WJ, Brady MF, Kucera PR, Partridge EE, Look KY, et al.: Cyclophosphamide and cisplatin compared with paclitaxel and cisplatin in patients with stage III and stage IV ovarian cancer. N Engl J Med 1996, 334:1–6.PubMedCrossRef 11. Piccart MJ, Bertelsen K, James K, Cassidy J, Mangioni C, Simonsen E, et al.: Randomized intergroup trial of cisplatin-paclitaxel versus cisplatin-cyclophosphamide selleck in women with advanced epithelial ovarian cancer: three-year results. J Natl Cancer Inst 2000, 92:699–708.PubMedCrossRef 12. Behrens BC, Hamilton TC, Masuda H, Grotzinger KR, Whang-Peng J, Louie KG, et al.: Characterization of a cis-diamminedichloroplatinum(II)-resistant human ovarian cancer cell line and its use in evaluation of platinum ADP ribosylation factor analogues. Cancer Res 1987, 47:414–418.PubMed 13. Levin L, Hryniuk WM: Dose intensity analysis of chemotherapy regimens in ovarian carcinoma. J Clin Oncol 1987, 5:756–767.PubMed 14. Levin L, Simon R, Hryniuk W: Importance of multiagent chemotherapy regimens in ovarian carcinoma: dose intensity analysis. J Natl Cancer Inst 1993, 85:1732–1742.PubMedCrossRef 15. Dauplat J, Legros M, Condat P, Ferriere JP, Ben Ahmed S, Plagne

R: High-dose melphalan and autologous bone marrow support for treatment of ovarian carcinoma with positive second-look operation. Gynecol Oncol 1987, 34:294–298.CrossRef 16. Viens P, Maraninchi D, Legros M, Oberling F, Philip T, Herve P, et al.: High dose melphalan and autologous marrow rescue in advanced epithelial ovarian carcinomas: a retrospective analysis of 35 patients treated in France. Bone Marrow Transplant 1990, 5:227–233.PubMed 17. Bertucci F, Viens P, Delpero JR, Bardou VJ, Faucher C, Houvenaeghel G, et al.: High-dose melphalan-based chemotherapy and autologous stem cell transplantation after second look laparotomy in patients with chemosensitive advanced ovarian carcinoma: long-term results. Bone Marrow Transplant 2000, 26:61–67.PubMedCrossRef 18.

7.2.0 software. The sequences were aligned using ClustalW and a consensus sequence

for each gene was used for specific primer design (Table 2). PCR was performed in a final volume of 25 μL containing 20 mM Tris–HCl, pH 8.4, 5 mM KCl, 1.5 mM MgCl2, 100 μM of each dNTP, 5 pmol of each forward and reverse primer, 2.5 U Taq DNA polymerase (Invitrogen, São Paulo, Brazil), and 2 μL of genomic DNA. The amplification reactions were performed in a Veriti® 96-well Thermal Cycler (Applied Biosystems) with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, annealing at 60°C for 1 min and an extension step at 72°C for 45 s. Negative control reactions without any template DNA were carried out simultaneously. The identity of the Forskolin in vivo amplicons was confirmed after determination of the nucleotide sequences with a 3730xl DNA Analyzer (Applied Biosystems) using the Big Dye® Terminator v.3.1 Cycle Sequencing Kit. Search for homologies in the GenBank/EMBL databases was carried out with the Blast algorithm. Table 2 Description of primers used in PCR for the detection of virulence markers and erythromycin/clindamycin-resistance genes Target genea

Sequence of the primer (5′ → 3′) Amplicon size (bp) Accession numberb hylB F: TGTCTCCGAGGTGACACTTGAACT 124 U15050.1/Y15903.1 R: TTGTGTTGTGACGGGTTGTGGATG cylE F: TCGGAACAAGTAAAGAGGGTTCGG 130 AF093787.2/AF157015.2 R: GGGTTTCCACAGTTGCTTGAATGT PI-1 F: AACCACTAGCAGGCGTTGTCTTTG 147 EU929540.1/EU929469.1 R: TGAGCCCGGAAATTCTGATATGCC Kinase Inhibitor Library PI-2a F: GCCGTTAGATGTTGTCTTCGTACT 117 EU929374.1/EU929330.1 R: TTTACTGCGGTCCCAAGAGCTTC PI-2b F: AAGTCTTGACCAAGGATACGACGC 152 EU929426.1/EU929391.1 R: ATCGTGTTACTTGCCCTGCGTA ermA F: CCGGCAAGGAGAAGGTTATAATGA 190 EU492925.1/EU492926.1 R: GCATTCACCCGTTGACTCATTTCC ermB F: GCTCTTGCACACTCAAGTCTCGAT 117 EF422365.1/DQ250996.1 R: ACATCTGTGGTATGGCGGGTAAGT mefA/E F: GCGATGGTCTTGTCTATGGCTTCA 225 DQ445273.1/DQ445269.1   R: AGCTGTTCCAATGCTACGGAT     a hylB, hyaluronate lyase; cylE, hemolysin/cytolysin (β-H/C); PI-1, PI-2a, PI-2b, pilus islands; ermA, ermB cross-resistance to macrolides-lincosamide-streptogramin

B; mefA/E resistance only to 14- and 15-membered ring macrolides. bThe nucleotide sequences of Streptococcus either agalactiae genes deposited in the GenBank/EMBL databases used for specific primer design. Ethics statements The study protocol was approved by the Ethics Committee of the Universidade Estadual de Londrina (Document 186/09-CEP/UEL). Written informed consent was obtained from the patients for the publication of this report and any accompanying images. Acknowledgements This study was supported by grants from Decit/SCTIE/MS/CNPq, FundaçãoAraucária e SESA-PR (Edital PPSUS: Gestão Compartilhada em Saúde – 2011). This work was part of the M.Sc. dissertation of E.S. Otaguiri, who received a student scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). We thank Dr. A.

It plays essential roles in promoting cell proliferation [8–11]. Our previous studies have shown that HSP70 could interact with C23 and inhibiting H2O2-induced cleavage and degradation of C23, thereby inhibiting reactive oxygen species-induced cell apoptosis [12]. There EPZ-6438 nmr were two ways for radiotherapy to destruct tumor cells: (1) X-ray directly broke the DNA of the cancer cells into fragmentations, leading to cell apoptosis; (2) X-ray released free radicals from other components (e.g. H2O) in the cells thereby to attack tumor cells. Theoretically, radiotherapy could result in cleavage and degradation of C23 and sequentially kill the tumors. In the present study, we determined whether reduction

of HSP70 expression could enhance radiosensitivity

of LSCC by increasing C23 cleavage and degradation. Materials and methods Tissue Microarray High-quality tissue microarray (TMA) was constructed with fifty tumor samples including different stages of LSCC. The clinicopathologic features of the participants included in this analysis were presented in Table 1. Briefly, serial 5-μm sections were cut from each of the donor blocks. One of Ponatinib chemical structure these sections was stained with hematoxylin and eosin staining (H&E) to mark morphologically representative areas of the tumor. Two areas in each case were targeted. Tissue cylinders with a diameter of 0.6 mm were punched from the two targeted areas in each donor crotamiton block and deposited into a 14 × 7+2 (100 cores) TMA block, which

contained 50 cores of tumor tissues. At last we gained 80 slides of high-quality TMA. Immunostaining for HSP70 protein was performed by using TMAs. Table 1 Clinicopathologic characteristics of participants of TMA Clinicopathologic characteristics of participants of TMA Male 45 Female 5 Average Age 61.3 ± 4.2 Stage I, II 21 Stage III, IV 29 RNA oligos According to the design principle of oligodexynucleotide (ODN) probes described by Myers KJ and Branch AD [13, 14], three antisense-ODNs (ASODNs) were designed artificially against the HSP70 mRNA complete sequence (GeneBank NO.BC002453) from http://​www.​ncbi.​nlm.​nih.​gov/​. Three ASODNs were synthesized with phosphorothioate modification by Bioasia Co. Ltd. (Shanghai, China). After screening an effective ASODN, AS-1(5′-X TGTTTTCTTGGCCAT -3′), which complemented to the first 20 coding sequences of HSP70 mRNA, random oligos (5′-X GATTATCGTGTTGTTACT -3′) were used as negative controls against AS-1, X represents green fluorescent marker. Animals and treatment BALB/c female mice (18-22 g, 4-6 weeks) were obtained from Laboratory Animal Centre, Xiangya School of Medicine, Central South University (changsha, China). The animals were housed for 1 week prior to experiment. The animal experiments were undertaken within the guidelines of regulations for the use of experimental animals of Central South University.

12JJ5048). References 1. Parkin DM, Bray F, Ferlay J, Pisani P: Global cancer statistics,

2002. CA Cancer J Clin 2005, 55:74–108.CrossRef 2. Sherman M: Hepatocellular carcinoma: epidemiology, risk factors, and screening. Semin Liver Dis 2005, 25:143–154.CrossRef 3. Bagnato VS, Kurachi C, Ferreira J, Sankarankutty AK, Zucoloto S, De Castro e Silva O: New photonic technologies for the treatment and diagnosis of hepatic diseases: an overview of the experimental work performed in collaboration, between Physics Institute of Sao Carlos and Ribeirao Preto Faculty of Medicine of the University of Sao Paulo. Acta Cir Bras 2006,21(Suppl 1):3–11. 4. Allison RR, Sibata CH: Oncologic photodynamic therapy photosensitizers: a clinical review. Photodiagn Photodyn Ther 2010, 7:61–75.CrossRef 5. Chen B, Roskams T, de Witte NU7441 research buy PA: Antivascular

tumor eradication by hypericin-mediated photodynamic therapy. Photochem Photobiol 2002, 76:509–513.CrossRef 6. Konan YN, Gurny R, Allemann E: State of the art in the delivery of photosensitizers for photodynamic therapy. J Photochem Photobiol B BAY 57-1293 molecular weight Biol 2002, 66:89–106.CrossRef 7. Soncin M, Polo L, Reddi E, Jori G, Kenney ME, Cheng G, Rodgers MA: Effect of the delivery system on the biodistribution of Ge(IV) octabutoxy-phthalocyanines in tumour-bearing mice. Cancer Lett 1995, 89:101–106.CrossRef 8. Hatakeyama H, Akita H, Harashima H: A multifunctional envelope type nano device (MEND) for gene delivery to tumours based on the EPR effect: a strategy for overcoming the PEG dilemma. Adv Drug Deliv Rev 2011, 63:152–160.CrossRef 9. Garg AD, Nowis D, Golab J, Vandenabeele P, Krysko DV, Agostinis P: Immunogenic cell death, DAMPs and anticancer therapeutics: an emerging amalgamation. Biochim Biophys Acta Low-density-lipoprotein receptor kinase 1805, 2010:53–71. 10. Kennedy JC, Pottier RH, Pross DC: Photodynamic therapy with endogenous protoporphyrin

IX: basic principles and present clinical experience. J Photochem Photobiol B Biol 1990, 6:143–148.CrossRef 11. Ascencio M, Collinet P, Farine MO, Mordon S: Protoporphyrin IX fluorescence photobleaching is a useful tool to predict the response of rat ovarian cancer following hexaminolevulinate photodynamic therapy. Lasers Surg Med 2008, 40:332–341.CrossRef 12. De Rosa FS, Bentley MV: Photodynamic therapy of skin cancers: sensitizers, clinical studies and future directives. Pharm Res 2000, 17:1447–1455.CrossRef 13. Bechet D, Couleaud P, Frochot C, Viriot ML, Guillemin F, Barberi-Heyob M: Nanoparticles as vehicles for delivery of photodynamic therapy agents. Trends Biotechnol 2008, 26:612–621.CrossRef 14. Couleaud P, Morosini V, Frochot C, Richeter S, Raehm L, Durand JO: Silica-based nanoparticles for photodynamic therapy applications. Nanoscale 2010, 2:1083–1095.CrossRef 15. Deng X, Xiong L, Lin L, Xiong G, Miao X: Photosan-II loaded hollow silica nanoparticles: preparation and its effect in killing for QBC939 cells.

The majority of the proteins detectable by Coomassie blue staining were not affected by trypsin treatment, indicating that cytoplasmic proteins were not exposed to proteolysis. Globomycin inhibited PhoA processing When pTAP transformant cells were grown with increasing concentrations of globomycin, cell growth was inhibited. A concentration of 25 μg globomycin/ml was the highest

to still allow growth of cells. Growth in 25 μg globomycin/ml resulted in an increase in the molecular weight of PhoA (Figure 3A, lane 25 μg/ml) compared to that seen in cells grown in the absence of globomycin (Figure 3A, lane 0 μg/ml). Figure 3 Lipoprotein processing of PhoA. A. Effect of globomycin on the processing of PhoA. Mycoplasma transformants were grown in broth without or with globomycin added, as indicated above each lane, and their Selleckchem Autophagy inhibitor proteins separated on 10 % SDS-polyacrylamide gels, Western transferred and immunostained using a MAb to AP. In cells grown in globomycin (25 μg/ml), and thus in which signal peptidase II

was inhibited, a higher molecular weight band was seen, indicative of the presence of the prolipoprotein. In the absence of globomycin (0 μg/ml) the fully processed 47 kDa lipoprotein is seen. B. Radiolabelling of PhoA. M. gallisepticum cell proteins and pTAP transformed M. gallisepticum cells were radiolabelled Palbociclib nmr with [14 C]palmitate and separated on 10 % SDS-polyacrylamide gels. The polyacrylamide gels were stained with Coomassie brilliant blue and autoradiographed or

Western transferred and immunostained using a MAb to AP. Lanes 1, M. gallisepticum cells; 2, pTAP transformed cells. Panels CB, Coomassie brilliant blue stained; WB, Western transferred and immunostained; RL, radiolabelled and autoradiographed. The dark arrow indicates the 67 kDa VlhA protein and the open arrow indicates the 47 kDa protein. Radiolabelling of lipid modified proteins Lipoproteins of M. gallisepticum transformed with pTAP were radiolabelled with [14 C]palmitate, separated by SDS-PAGE gel and either stained with Coomassie brilliant blue (Figure 3B, CB) and autoradiographed (Figure 3B, RL) or Western transferred and immunostained (Figure 3B, WB). Following autoradiography, a band of 47 kDa, similar to the expected size of alkaline phosphatase, was detected in the pTAP transformed cells (Figure L-NAME HCl 3B, RL, 2), suggesting that PhoA in pTAP transformed M. gallisepticum was a lipoprotein. A Western blot immunostained with a MAb to AP demonstrated the presence of a recombinant AP protein of similar size to that of the radiolabelled band in pTAP-transformed M. gallisepticum (Figure 3B, WB, 2). Two-dimensional gel electrophoresis and mass spectrometric analysis of PhoA proteins Following separation of Triton X-114 preparations of protein by 2-D gel electrophoresis, a spot corresponding to PhoA was excised, digested with trypsin and analysed by mass spectrometry.

It appears that the overexpression of topB prevents growth of cells that retain the topA plasmid, in line

with previous results showing that increased levels of topoisomerase III are toxic for E. coli wild type cells [14, 19]. Figure 2 The lethality of ΔtopA cells can be suppressed by increased levels of DNA topoisomerase III, but not by overexpression of recG. (A) Arabinose-induced expression of topB, which codes for DNA topoisomerase III, leads to formation of white colonies. The selleck kinase inhibitor smaller colony size indicates that the suppression is only partial. Increased levels of DNA topoisomerase III are toxic for E. coli cells, leading to reduced numbers of blue colonies as well as aberrant colony morphologies (compare the two enlarged colonies in Ai and Aii). (B) Increased levels of RecG support growth of ΔtopA cells only marginally The ΔtopA lethality is not suppressed by overexpression of rnhA or recG It was previously reported that the growth defect of cells lacking topoisomerase I can be suppressed by increased concentrations of RNase HI. Furthermore, ΔtopA ΔrnhA double mutants were found to be inviable even in the presence of point mutations that strongly suppress the ΔtopA phenotype [7]. This led to the suggestion that

RNA:DNA hybrids might be a major problem for ΔtopA cells [7]. We therefore investigated whether RecG helicase suppressed the ΔtopA phenotype. RecG protein was shown to unwind the RNA from R-loops in Atezolizumab vitro [20, 21] and overexpression of recG results in reduced yields of ColEI plasmids that initiate replication via an R-loop [20], suggesting Adenylyl cyclase that RecG can process R-loops in vivo. To investigate whether recG overexpression suppresses the ΔtopA phenotype we used an overexpression construct as described for topB (see Material and Methods). The plasmid fully suppressed the phenotype of cells lacking RecG if expression was induced, whereas no suppression

was observed under conditions where expression was repressed [22]. As shown in Figure 2B expression of recG at high levels only marginally suppressed the topA phenotype. Our data suggest that R-loop processing activity of RecG is not sufficient to suppress the ΔtopA phenotype efficiently. To confirm that elevated concentrations of RNase HI suppress the growth defect of cells lacking topoisomerase I we repeated the experiment with a P araBAD rnhA plasmid. However, medium expression levels of rnhA from a P araBAD plasmid proved toxic for the cells (Additional file 2: Figure S2), presumably because the high levels of RNase HI degrade the R-loop required to initiate replication at the pMB1 origin. To avoid this problem we amplified the rnhA locus including the arabinose promoter region and integrated the construct into the proB locus, using standard single-step gene replacement [23].

To me, this is real success. My wife always tells me that only the tree, which bears fruits, has its branches bent because of the weight of the fruits. I have seen this in Govindjee

and Rajniji. They are laden with fruits of success and achievement, find more yet they never boast of them and always treat people humbly. This is true embodiment of greatness. I once read “greatness” is better, but gratefulness is much better. In the Govindjees, I have found this quality, and that too for the first time in my life. They harbor no grievance against any person and are ready to go long ways to help people everywhere in the world. We wish them a long, meaningful, productive, prosperous, peaceful and fruitful life. I wish Vijay (i.e., Victory) to Govindjee on his 80th birthday celebration on October 24, 2013, by the journal Photosynthesis Research (being edited by Suleyman Allakhverdiev (of Russia), Selleck CH5424802 Gerald Edwards (of USA), and Jian-Ren Shen (of Japan)) that he has served with dedication over

the many years. When I started learning about photosynthesis from my father Late Swami Dayal Tewari, who had received his Master’s degree in Botany, from Allahabad University (the same University where Govindjee later received his Master’s degree in Botany, in 1954), I was made aware of Blackman’s law of limiting reactions: it seemed to be the most important concept for the understanding of photosynthesis. For me, Rabinowitch and Govindjee’s 1969 book provided, for the first time, basic understanding about it, and the rest of the many concepts in

photosynthesis, and that in simple terms. I cherished it then and I cherish it now. Over 50 years ago, the 1931 Nobel-laureate filipin Otto Heinrich Warburg discovered a unique stimulatory role of CO2 in the Hill reaction (i.e., O2 evolution accompanied by reduction of an artificial electron acceptor), which, obviously, does not include any carbon fixation pathway. Warburg had used this discovery to support his idea that O2 in photosynthesis originates in CO2. During the 1960s, a large number of researchers attempted to decipher this unique phenomenon, with limited success. In the 1970s, Alan Stemler, Govindjee’s PhD student, perfected methods to get highly reproducible results, and observed, among other things, that the turnover of Photosystem II (PS II) was stimulated by bicarbonate ions (hydrogen carbonate): the effect would be on the donor or the acceptor, or both sides of PS II. In 1975, Thomas Wydrzynski, also Govindjee’s PhD student, discovered that there was a definite bicarbonate effect on the electron acceptor (the plastoquinone) side of PS II. The most recent 1.

Those extreme cases, together with the very high prevalence of RWL achieved by aggressive methods, illustrate quite clearly that the scenario is disturbing, the problem may be more

serious than many people involved with the sport may think and that more attention to this problem should indeed be given. Strategies to avoid decreased performance after rapid weight loss Selleck GSK1120212 No athlete should be encouraged to cut weight quickly in order to compete in a lighter weight class. Although performance may not be affected, an athlete’s health is always at risk. If an athlete needs to adjust his/her body weight, there are strategies check details that one can follow to help minimize the potential adverse effects: [14, 20, 50–52]: 1) Gradual weight loss (i.e.,<1 kg.week−1), rather than RWL, must be the preferential method for adjusting weight.   2) Athletes should aim to maximize body fat loss and minimize muscle wasting and dehydration when adjusting weight.   3) An athlete who needs to reduce more than 5% of body weight should consider not losing weight.   4) An athlete who needs cut weight so that his/her body fat would lower than 5% for men and 12% for women should consider not

losing weight.   5) During the weight loss period, strength training and BCAA supplementation may help preserve muscle mass.   6) Athletes should not undergo low-carbohydrate diets in order to make weight as they seem to be more detrimental to Protein kinase N1 physical performance [41].   7) If an athlete will have less than 3 hours to recovery after the weigh-in, RWL, dehydration and restricted carbohydrate ingestion should be avoided.   8) During the recovery

period after weigh-in, athletes are encouraged to consume high amounts of carbohydrates, fluids and electrolytes. Creatine supplementation may also be of use if the athlete will recover for a long period after weighing-in.   Management strategies to avoid rapid weight loss practices Control strategies to avoid RWL practices can be divided in two areas: (1) coach and athlete educational programs; (2) management procedures to control or discourage RWL. Coach and athlete educational programs Considering that most athletes follow their coaches’ recommendations to execute RWL [5, 8, 17], the best strategy is to make both coaches and athletes fully aware of the risks involved with RWL and the recommended procedures to gradually reduce body mass [17].

The Tokyo guidelines proposed a staging system based upon the evaluation of local signs of inflammation (Murphy’s sign and RUQ mass/pain/tenderness), systemic signs (fever, elevated CRP with values of 3 mg/dl or more and abnormal WBC count) and imaging findings characteristic of acute cholecystitis. Similar diagnostic criteria are reported from other recent studies [4, 14]. As far as diagnosis and treatment of acute cholecystitis is concerned, the peculiarity of the Tokyo guidelines is the division of the disease in mild, moderate

and severe [6, 7]. No previous study examined the optimal treatment of acute cholecystitis on the basis of an organ-related severity score index. In the Tokyo consensus meeting the need for surgical treatment according to the grade of severity was suggested and discussed [7]. Subsequent studies analyzed the impact of the Tokyo guidelines on the management of patients with acute cholecystitis, stressing the attention on their impact on buy Bortezomib Silmitasertib datasheet surgical outcomes. Even if the

expert panel of that consensus made an extraordinary scientific work, no benefits have been demonstrated by applying those guidelines, except a decrease of mean length of hospital stay [8]. Acute cholecystitis could present with a picture ranging from mild, self limiting, to a potentially life threatening illness [6]. However the severity of inflammation and its life threatening potential is also strongly determined by the general condition of the patient, and the surgical treatment is often dictated more by the general conditions of the patient than by the grade of inflammation/infection of the

gallbladder. Actually no randomized controlled trials have examined the optimal surgical treatment for acute cholecystitis according to its severity grade and the panel at the Tokyo consensus meeting included patients with organ/systemic dysfunctions in the “”grade III”" of the guidelines, with the suggestion that these patients should receive delayed cholecystectomy after urgent drainage. Early gallbladder drainage is suggested also in grade II patients, with local severe inflammation, however a later systematic review of 53 papers about cholecystostomy Dolichyl-phosphate-mannose-protein mannosyltransferase as an option in acute cholecystitis found no evidence to support the recommendation of percutaneous drainage rather than straight early emergency cholecystectomy even in critically ill patients, and stated that it is not possible to make decisive recommendations about it. From their data, actually, cholecystectomy seems to be a better option than early drainage, for treating acute cholecystitis in the elderly and/or critically ill population [15]. Borzellino et al., in a recent review of prospective and retrospective series did not show an increase in local postoperative complications in laparoscopically treated severe (gangrenous and empyematous) acute cholecystitis but did not address the issue of timing of intervention in this subset of patients [16].

However, often the search for microbial agents is performed only after a disease state has been diagnosed. Only a few investigations including urine from healthy persons using 16S rDNA PCR have been reported [12, 24–26]. These studies

had a variable success rate in actually obtaining sequences, resulting in a limited overview of the healthy urine bacterial flora. However, two recent 16S rDNA studies by Nelson et al. (2010) and Dong et al. (2011) [27, 28] have shown that the male urine contains multiple bacterial genera. Advances in sequencing technology, such as massively parallel EGFR targets pyrosequencing as developed by 454 Life Sciences [29], allow for extensive characterization of microbial populations in a high throughput X-396 mouse and cost effective manner [30, 31]. Amplicons of partial 16S

rRNA genes are sequenced on microscopic beads placed separately in picoliter-sized wells, bypassing previously needed cloning and cultivation procedures. Such sequencing has revealed an unexpectedly high diversity within various human-associated microbial communities, e.g. oral-, vaginal-, intestinal- and male first catch urine microbiota [4, 28, 32, 33], but female urine microbial diversity has so far not been studied using high throughput sequencing (HTS) methods. Here, we have investigated the bacterial diversity in urine microbiota from healthy females by means of 16S rDNA amplicon 454 pyrosequencing. This study demonstrates the use of this methodology for investigating bacterial sequence diversity in female urine samples. Our results indicate a diverse spectrum of bacterial profiles associated with healthy, culture negative female urine and provide a resource for further studies in the field of molecular diagnostics of urine specimens. Methods Urine sampling Urine was collected by the clean catch method 6-phosphogluconolactonase in which healthy adult female volunteers (n = 8),

collected midstream urine into a sterile container. Specimens were initially kept at 4°C, and within an hour transported to the laboratory for DNA isolation. All specimens were culture negative, as tested by the Urological Clinic at the University Hospital HF Aker-Oslo. Samples were taken with informed consent and the study was approved by the Regional Committee for Medical Research Ethics East-Norway (REK Øst Prosjekt 110-08141c 1.2008.367). DNA isolation 30 ml urine volume was pelleted by centrifugation at 14000 RCF for 10 min at 4°C. 25 ml of the supernatant was decanted and the pellet was resuspended in the remaining volume. 5 ml of the sample was again pelleted by centrifugation for 10 min at 16000 × g (4°C). The pellet and some supernatant (up to 100 μl) were processed further. DNA was isolated from the urine pellets with DNeasy Blood & Tissue kit (QIAGEN, Germany), following the tissue spin-column protocol with minor modifications.