7.2.0 software. The sequences were aligned using ClustalW and a consensus sequence

for each gene was used for specific primer design (Table 2). PCR was performed in a final volume of 25 μL containing 20 mM Tris–HCl, pH 8.4, 5 mM KCl, 1.5 mM MgCl2, 100 μM of each dNTP, 5 pmol of each forward and reverse primer, 2.5 U Taq DNA polymerase (Invitrogen, São Paulo, Brazil), and 2 μL of genomic DNA. The amplification reactions were performed in a Veriti® 96-well Thermal Cycler (Applied Biosystems) with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, annealing at 60°C for 1 min and an extension step at 72°C for 45 s. Negative control reactions without any template DNA were carried out simultaneously. The identity of the Forskolin in vivo amplicons was confirmed after determination of the nucleotide sequences with a 3730xl DNA Analyzer (Applied Biosystems) using the Big Dye® Terminator v.3.1 Cycle Sequencing Kit. Search for homologies in the GenBank/EMBL databases was carried out with the Blast algorithm. Table 2 Description of primers used in PCR for the detection of virulence markers and erythromycin/clindamycin-resistance genes Target genea

Sequence of the primer (5′ → 3′) Amplicon size (bp) Accession numberb hylB F: TGTCTCCGAGGTGACACTTGAACT 124 U15050.1/Y15903.1 R: TTGTGTTGTGACGGGTTGTGGATG cylE F: TCGGAACAAGTAAAGAGGGTTCGG 130 AF093787.2/AF157015.2 R: GGGTTTCCACAGTTGCTTGAATGT PI-1 F: AACCACTAGCAGGCGTTGTCTTTG 147 EU929540.1/EU929469.1 R: TGAGCCCGGAAATTCTGATATGCC Kinase Inhibitor Library PI-2a F: GCCGTTAGATGTTGTCTTCGTACT 117 EU929374.1/EU929330.1 R: TTTACTGCGGTCCCAAGAGCTTC PI-2b F: AAGTCTTGACCAAGGATACGACGC 152 EU929426.1/EU929391.1 R: ATCGTGTTACTTGCCCTGCGTA ermA F: CCGGCAAGGAGAAGGTTATAATGA 190 EU492925.1/EU492926.1 R: GCATTCACCCGTTGACTCATTTCC ermB F: GCTCTTGCACACTCAAGTCTCGAT 117 EF422365.1/DQ250996.1 R: ACATCTGTGGTATGGCGGGTAAGT mefA/E F: GCGATGGTCTTGTCTATGGCTTCA 225 DQ445273.1/DQ445269.1   R: AGCTGTTCCAATGCTACGGAT     a hylB, hyaluronate lyase; cylE, hemolysin/cytolysin (β-H/C); PI-1, PI-2a, PI-2b, pilus islands; ermA, ermB cross-resistance to macrolides-lincosamide-streptogramin

B; mefA/E resistance only to 14- and 15-membered ring macrolides. bThe nucleotide sequences of Streptococcus either agalactiae genes deposited in the GenBank/EMBL databases used for specific primer design. Ethics statements The study protocol was approved by the Ethics Committee of the Universidade Estadual de Londrina (Document 186/09-CEP/UEL). Written informed consent was obtained from the patients for the publication of this report and any accompanying images. Acknowledgements This study was supported by grants from Decit/SCTIE/MS/CNPq, FundaçãoAraucária e SESA-PR (Edital PPSUS: Gestão Compartilhada em Saúde – 2011). This work was part of the M.Sc. dissertation of E.S. Otaguiri, who received a student scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). We thank Dr. A.