Recent progress in electrospinning has greatly expanded the scope of available morphologies and RG7420 chemical structure properties for nanofibers, which further contributes to their applications [12–18]. For example, porous materials have been found in widespread applications such as filtration, catalysis,

and biomedical research due to their great increase of surface area and porosity of nanofibers [12]; beaded nanofibers have been used to design superoleophobic surfaces by mimicking the surface of a lotus leaf [13]; and core/shell nanofibers have been applied to the control of drug release by maneuvering drug in the core under specific conditions [14]. Previously, we have reported the fabrication of cellulose acetate butyrate (CAB) and PS fibers with a parallel line surface texture via electrospinning using a mixed solvent system consisting of a highly volatile solvent (e.g., acetone) and a nonvolatile organic solvent [15, 16]. These grooved fibers have shown a great potential in the area of tissue BI 2536 cell line engineering and superhydrophobic surfaces. However, how to fabricate grooved fibers with controlled diameters and groove properties (e.g., number of grooves, width between two adjacent grooves, and depth of grooves) is

still a challenge, which hampers the further development and applications of grooved nanofibers. PS excels in the production of electrospun fibers with various morphologies. Considerable efforts [12, 16, 19–22] have been devoted to the investigation of the secondary structures (e.g., porosity on the surfaces, wrinkled surface, interior porosity) of PS fibers. Although PS fibers with small grooved surfaces have been reported in several studies [20, 22], none of them

demonstrated how to control this secondary texture. Furthermore, the diameter of grooved PS fibers was normally larger than 1 μm [16]. In this work, grooved nanofibers with an average diameter of 326 ± 50 nm were obtained through optimizing the process parameters. By systematically investigating the influence of variables on the secondary morphology of electrospun PS fibers, we singled out that solvent system, solution concentration, and relative Megestrol Acetate humidity were the three most significant factors in determining the generation of the grooved structure of PS fibers and elucidated the formation mechanism of grooved texture. Methods Chemicals and materials PS (Mw = 350,000 g/mol) was purchased from Sigma-Aldrich, Inc, St. Louis, MO, USA. Tetrahydrofuran (THF) and N,N-dimethylformamide (DMF) were purchased from Shanghai Chemical Reagents Co., Ltd, Shanghai, China. All materials were used without further purification. Electrospinning The PS solution was placed into a syringe with an internal diameter of 0.

These results indicate that carboxylated MNC and Apt-MNC are

biocompatible for use as MR imaging probes. Figure 4 Cell viabilities of U87MG cells treated with different concentrations of Apt-MNC and carboxylated MNC. To assess the in vitro VEGFR2-targeting ability of Apt-MNC, VEGFR2-overexpressing PAE/KDR cells were treated with Apt-fluorescein, and the cells PCI-32765 were analyzed by flow cytometry (Figure  5a). PAE/KDR cells treated with Apt-fluorescein exhibited fluorescence levels of 76.8% (green) when compared with that of non-treated PAE/KDR cells (control, 0.5% fluorescence level, black). PAE/KDR cells treated with Apt-fluorescein were analyzed by confocal microscopy (Figure  5b). Cells exhibited fluorescence in the nuclei (blue, DAPI) and in the cytoplasm (green, fluorescein); this confirmed that Apt could effectively bind to VEGFR2 expressed on PAE/KDR cells. The cellular binding efficiency of Apt-MNC was investigated using dark-field microscopy. In Figure  6, the scattered spots (yellow arrows) on PAE/KDR cells treated with Apt-MNC were observed due to MNC. However, Fostamatinib research buy carboxylate MNC without

Apt conjugation was not observed in non-treated PAE/KDR cells. These results indicate that Apt-MNC effectively targeted VEGFR2-expressing cells [19]. Figure 5 In vitro VEGFR2-targeting ability of Apt. (a) Flow cytometry data of porcine aortic endothelial cells with overexpressing kinase insert domain receptor (PAE/KDR) cells treated with or without Apt-fluorescein. (b) Confocal microscopy images of PAE/KDR cells treated with DAPI (nucleus, blue) and Apt-fluorescein (cytoplasm, green). Figure 6 Dark-field microscopy images

of PAE/KDR Sinomenine cells. (left panel) Non-treated and (right panel) treated with Apt-MNC; bars = 25 μm. To investigate in vivo VEGFR2-targeting ability of Apt-MNC using MR imaging, we prepared the glioblastoma-bearing mouse xenograft model by intracranial injection of U87MG cells into the brain. Although U87MG cancer cells did not express VEGFR2, they induced extensive VEGFR2 production through a tumor angiogenesis pathway when transplanted into mouse brain [20]. MR imaging for VEGFR2-expressing brain tumor was performed before and after intravenous injection of Apt-MNC and carboxylated MNC into the mouse tail vein (200 μg Fe), and the color map images of Apt-MNC and carboxylated MNC were presented to evaluate accurately the contrast change (Figure  7a). Before the administration of both MNC solutions (pre-injection), each T2-weighted MR image of the tumor site appeared characteristically bright with a low R2 value. Following injection of Apt-MNC or carboxylated MNC (postinjection), we observed that the tumor sites showed darkened images due to the presence of magnetic components.

0 × 10-5 errors per base [39]. Therefore, only SNPs detected in all three samples with high coverage and multiple variant

copies were likely true positive SNPs. Conclusions We deep-sequenced dscDNA libraries derived from three culture conditions of Frankia sp. CcI3. Overall gene expression varied more as a function of culture age than as a function of nitrogen deprivation, likely because the cell population has fewer actively growing cells at the fifth day of culture and those remaining are adapting to nutrient deprivation. In two limited nutrient environments, transposase ORFs were relatively more highly expressed than in younger ammonium grown cells. A RT-qPCR assay designed to quantify highly duplicated transposase ORFs supported the selleck chemicals llc data from the mRNA-seq experiment. These results, in tandem with discovery of putative SNPs, suggests that the IS element laden CcI3 genome is in constant flux within the relatively Selleckchem Temozolomide mundane conditions of a culture flask. Methods Culture media and conditions Frozen stocks of Frankia sp. strain CcI3, were suspended in duplicate in 200 ml of Frankia Defined Minimal media (FDM) containing 45 mM sodium pyruvate and 9.3 mM ammonium chloride in 500 ml flasks [40]. Cells were grown at 30°C for three or five days on FDM with or without (N2 fixing cells) ammonium. Nitrogen fixing cultures were prepared using a modified iron stock

as previously described [24]. Given the difficulty in quantifying viable Frankia cells in culture, a total of three ml of gravity-settled Selleckchem Hydroxychloroquine cells were harvested per culture

flask for RNA extraction. RNA extraction Frankia cells were processed using a ZR Fungal/Bacterial RNA MiniPrep™ kit from Zymo Research© (http://​www.​zymoresearch.​com) using the manufacturer’s recommendations. To completely remove genomic DNA (gDNA) contamination from the RNA extraction, we performed the in-column DNAse I optional step using Amplification grade DNAse I (Invitrogen™, http://​www.​invitrogen.​com). DNAseI incubation times were extended to 30 minutes at 37°C in order to completely remove gDNA from the sample. A final elution volume of 15 μl of RNAse free water was used instead of the recommended 6 μl elution volume. Only RNA samples with a 260/280 nm wavelength ratio above 2.00 were used for library construction and RT-qPCR assays. In order to enrich mRNA content for generating a cDNA library, we used the MICROBExpress™ Bacterial mRNA Enrichment Kit (Ambion Inc., http://​www.​ambion.​com). The manufacturer’s website specifies that the oligonucleotide sequence used by the kit should anneal to the 16S and 23S rRNA sequences of many eubacterial species including Frankia sp. Approximately 10 μg of Frankia total RNA in each condition was processed using the kit per the manufacturer’s instructions. This procedure yielded 2 – 3.75 μg of RNA after depletion for each sample.

For r 1=r 2=0, the wave function in the DSN exactly reduces to that of the DN. We analyzed the probability densities in the DN and in the DSN from Figures 2 and 3, respectively, with the choice of sinusoidal signal source. The probability densities in the DN given in Figure 2b,c,d oscillate with time. Moreover, their time behaviors are more

selleck or less distorted. The probability density, however, does not oscillate when there are no displacement and no signal of power source (see Figure 2a). The probability densities in the DSN are distorted much more significantly than those of the DN. The time behavior of probability densities of quantum states, Trametinib both the DN and the DSN, is highly affected by external driving power source. When there is no external power source( =0), the displacement of charges, specified with a certain initial condition, gradually disappears as time goes by like a classical state. The fluctuations and uncertainty products of charges and currents are derived in the DSN, and it is shown that their value is independent of the size of the particular solutions q j p (t) and p j p (t). From this, together with the fact that q j

p (t) and p j p (t) are determined by the characteristics of , it is clear that the electric power source does not affect on the fluctuation of canonical variables. If we ignore the time dependence of PAK5 F j (t) and , decrease exponentially with time, whereas increase exponentially. From Equations 64 and 65, we can see that the time behavior of q j is determined

by two factors: One is displacement and the other is the signal of power source. For better understanding of this, recall that the amplitude of complementary functions gives displacement of the system, and the particular solutions are closely related to external driving force (i.e., in this case, the power source). In this paper, we did not consider thermal effects for the system. The thermal effects, as well as dissipation, may be worth to be considered in the studies of quantum fluctuations of electronic circuits with nanosize elements because the practical circuits are always working in thermal states with the presence of damping. It may therefore be a good theme to investigate DSNs with thermalization as a next task, and we plan to investigate it in the near future. Appendix 1 The eighth formula of 7.

The effectiveness of this intervention is studied with a randomized controlled

trial (RCT) design. The results of the RCT will be published elsewhere (Varekamp et al. 2010). Set-up and contents of the training programme The training programme consisted of six three-hour sessions every 2 weeks and a seventh session 2 months after the sixth session. One trainer worked with eight participants. At two sessions, there was an actor present for practicing role-playing. To discuss personal problems and progress at more length, three individual consultations also took place, one at the beginning, one halfway through the training and one after the sixth session. The trainers were experienced in working with groups, had psychotherapeutic knowledge of the principles of rational emotive therapy (RET) and occupational psychology, and a basic understanding of chronic disease and its consequences. A pilot version of the programme buy AT9283 was first developed and tested. The pilot version was adapted based on the trainers’ experiences, the researcher’s observations, a pre- and post-test questionnaire and interviews with the participants by telephone. The programme had a stepwise approach: first, exploring and

clarifying work-related problems; second, a focus on communication at work; and third, developing and realizing solutions. find protocol Work-related problems were clarified with the help of the ‘Quality of work’ model, which emphasizes the energizing or distressing influences of work tasks, social relationships at work, working conditions and work-home interference. A seventy-page course book accompanied the training, and participants completed homework for every session. Org 27569 The sessions consisted of four to seven components, including discussion of the homework and preparations for the next session. Each session focused on one theme: 1. Exploration and clarification of practical and psychosocial work-related problems with the help of the model ‘Quality of work;’   2. Insight into feelings and thoughts about having a chronic disease

and how these may influence communication;   3. Communication in daily work situations: theory and role play with an actor;   4. Practical matters: the occupational physician, the employment expert, legislation and facilities for disabled employees;   5. Communication and assertiveness: theory and role play with an actor;   6. A SMART plan to solve problems; and   7. Follow-up: what works and what does not.  Participants were eligible for the intervention if they had a chronic physical disease, had a paid job, experienced problems at work and feared losing their job or job satisfaction. Workers with predominant psychiatric conditions were excluded; people with a chronic physical disease in combination with depression were not excluded. Workers on long-term full sick leave that was expected to extend into the following months were excluded.

One mouse ear/group was subjected to histological examination (Additional file

4) and the rest 4 ears/group were subjected to enumeration of staphylococci. Comparison of lysostaphin and LytM185-316 in the mouse model In the last in vivo experiment the staphylococcal strain P1 (106/ear) was used to infect ears of mice with eczema. Twelve hours after inoculation of bacteria the treatment with proteins was started; 100 μg of lysostaphin or Selleckchem CHIR 99021 LytM185-316 in 50 mM glycine pH 8.0 and 10% glycerol buffer was applied to each mouse ear in a volume of 20 μl. In the case of control mice buffer alone was used for the treatment. Ears were treated with proteins or buffer four times every 12 hours. Three hours after the last treatment mice were anesthetized and the ears dissected. The ears were washed with alcohol to remove surface bound bacteria, kept on ice, homogenized and diluted in PBS. One hundred microliter of the homogenate from various dilutions was then transferred to agar plates, containing 7.5% sodium chloride. After incubation at 37°C for 24 hours the colony forming units were counted. 10 mice were used in the control group and in each treatment group. Prior to the in vivo use, staphylococci were cultured

for 24 hours on blood agar plates, re-inoculated and grown on fresh blood agar plates for another 24 hours, harvested, and stored frozen at −20°C after suspending aliquots in phosphate-buffered saline (PBS) supplemented with 5% bovine serum albumin and 10% dimethyl sulphoxide.

Before application Alvelestat purchase on ears, staphylococcal suspensions were thawed, bacteria washed in PBS and diluted in PBS to achieve the appropriate concentration of the staphylococci. To determine the CFU, aliquots of staphylococcal suspensions were subjected to dilution, plating on blood agar and enumeration. Acknowledgements We are thankful to Drs Renata Filipek and Elzbieta Nowak for critical reading of the manuscript and fruitful discussions. This work was supported by the European Communities (“Novel non-antibiotic treatment of staphylococcal diseases”, specific RTD program QLRT-2001-01250, Center of Excelence in Bio-Medicine, EC FP7 grant “”Proteins in Health and Disease”" (HEALTH-PROT, Nintedanib (BIBF 1120) GA No 229676), by the Deutsche Forschungsgemeinschaft DFG (“Proteolyse in Prokaryonten: Kontrolle und regulatorisches Prinzip”, BO1733/1-1) and by the Polish Ministry of Education and Science (MEiN, decisions 1789/E-529/SPB/5.PR UE/DZ 600/2002-2005). M.B thanks the European Molecular Biology Organization (EMBO) and the Howard Hughes Medical Institute (HHMI) for Young Investigator support. Electronic supplementary material Additional file 1: Picture of mouse ears untreated (on the left) and treated (on the right) with oxazolone. (TIFF 407 KB) Additional file 2: Stability of LytM185-316 and lysostaphin. Proteins were incubated without (1) or with concentrated, conditioned S.

All animal experiments were conducted under the auspices of the Danish Animal Experiments Inspectorate, the Danish Ministry of Justice. Construction

of subclone libraries Purified fosmids were submitted to partial digestion HER2 inhibitor with BfuCI, after which ~4-12 kb DNA fragments were excised and purified from low-melting point agarose gels, and then ligated into the BamHI site of pACYC184 and transferred to E. coli EPI100. EPI100 subclones were selected by growth on LB plates containing 30 μg/ml chloramphenicol. Cloning of fosmid-derived colonisation promoting K. pneumoniae C3091 genes Genes or gene clusters were PCR amplified from the K. pneumoniae C3091 gene fragments of the respective selected fosmid-derived subclones. NSC 683864 cell line All primers used, and the restriction sites introduced at their 5’ ends, are listed in Table 1. The PCR products were digested with the respective restriction enzymes and ligated into the corresponding

sites of pACYC184. Table 1 Primers used in this study for construction of plasmids encoding colonisation promoting K. pneumoniae C3091 genes Primer Sequence (5’ → 3’)a recA-BspHI GCGCGCTCATGACGGAGCGGCGTGATGAAGG recA-HindIII GCGCGCAAGCTTAAATATTAACGGCGAAGCGAACAC arcA-BspHI GCGCGCTCATGATCGCGTGGACTGGTATGC arcA-HindIII GCGCGCAAGCTTTGAGCCGGGTAAAGATTGTGACTA kpn_01507-BspHI GCGCGCTCATGAGCAATGACCGCCGGGACAGGAG kpn_01508-HindIII GCGCGCAAGCTTTCTAGGATCGCCGGCACAATAATG a Restriction sites highlighted by underscoring. Bile salt sensitivity assay Overnight cultures were diluted 1:1000 in LB broth in the absence and presence of various concentrations of Bile Salts no. 3 (Difco) and incubated ~18 hrs at 37°C with shaking. The cultures were then diluted 1:10 in LB broth after which serial dilutions were plated. Statistical analysis Student’s t-test was used for statistical evaluation and p values < 0.05 were considered statistically significant. Acknowledgements This work was partially funded by the Danish Council for Strategic Research Grant 2101-07-0023 to Karen A. Krogfelt. References 1. Podschun

R, Ullmann U: Klebsiella spp. as nosocomial Afatinib research buy pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev 1998,11(4):589–603.PubMed 2. Ebringer A, Rashid T, Tiwana H, Wilson C: A possible link between Crohn’s disease and ankylosing spondylitis via Klebsiella infections. Clin Rheumatol 2007,26(3):289–297.PubMedCrossRef 3. Lee CH, Leu HS, Wu TS, Su LH, Liu JW: Risk factors for spontaneous rupture of liver abscess caused by Klebsiella pneumoniae. Diagn Microbiol Infect Dis 2005,52(2):79–84.PubMedCrossRef 4. Yang YS, Siu LK, Yeh KM, Fung CP, Huang SJ, Hung HC, Lin JC, Chang FY: Recurrent Klebsiella pneumoniae liver abscess: clinical and microbiological characteristics. J Clin Microbiol 2009,47(10):3336–3339.PubMedCrossRef 5. Lee IA, Kim DH: Klebsiella pneumoniae increases the risk of inflammation and colitis in a murine model of intestinal bowel disease. Scand J Gastroenterol 2011,46(6):684–693.PubMedCrossRef 6.

We found an inverse correlation (r = -0.82) between cell doubling time (DT) and 18F-FDG uptake; the shorter the doubling time, the higher the 18F-FDG uptake (p = 0.04; test for zero slope in a

linear regression of predicted 18F-FDG uptake at 1,000,000 viable cells on doubling time; n = 6). This inverse relationship was even stronger if the cell line Imatinib cell line LU-HNSCC 3 with no observations above 600,000 viable cells was omitted (r = -0.95; p = 0.01) or if the cell line LU-HNSCC 7 with no observations below 700,000 viable cells was omitted and the 18F-FDG uptake was predicted for 500,000 viable cells (r = -0.96; p = 0.01). The experiment was repeated with similar results. In brief, the correlations between 18F-FDG uptake and number of viable cells varied from 0.81 to 0.98 and the predicted 18F-FDG uptake at 1,000,000 viable cells varied significantly between the cell lines also in the second experiment (p < 0.0001). Also the negative correlation between 18F-FDG uptake and DT was reproduced in the second series (r = -0.70; p = 0.12; n = 6). By combining the data from the two experiments, the p-value for the inverse correlation between 18F-FDG uptake and DT dropped Autophagy inhibitor concentration to 0.004. Cisplatin sensitivity The cisplatin sensitivity of the different cell lines is illustrated in Figure 3. Significant differences in cisplatin sensitivity between the cell lines was seen at 5, 50 and 100 μM (p < 0.0001;

Kruskal-Wallis test). The values of IC50 for the different cell lines varied between 6 and 29 μM. The cisplatin sensitivity did not show any relationship with TP53 mutations, CCND1 amplification

or overexpression, or tumour doubling time. Thiamet G Figure 3 Survival curves of the different cell lines exposed to varying concentrations of cisplatin obtained by crystal violet assay. Each value represents an average of at least three experiment. Discussion In accordance with other studies [10–12], we found that tumours that could grow in vitro were more aggressive in their biological behaviour, with shorter patient disease-free periods and overall survival time, compared with those that did not grow in vitro. No correlation was found between ability to grow and clinical parameters such as TNM status, or tumour grade or site. In agreement with our results, Kim et al. established nine new permanent SCC cell lines, but their propensity to grow in vitro did not appear to be related to tumour site or grade [13]. Thus, in vitro growth, in the present study seems to be an independent prognostic factor, in concordance with other authors [10–12] although there also are reports on lack of such correlation [14]. The capacity of tumour cells to grow in vitro could be dependent on their genetic alterations. Support for this hypothesis comes from the finding that all the culturable cell lines, except for one in this study were seen to have complex karyotypes after short-term culturing.

That is, a mixture of thiosemicarbazide 4j (10 mmol) and 20 mL of 2 % aqueous solution of sodium hydroxide was refluxed for 2 h. Then, the solution was neutralized with diluted hydrochloric acid and the formed precipitate was filtered and crystallized from ethanol. Yield: 70.3 %, mp: 248–249 °C (dec.). Analysis for C16H13N3O2S (311.36); calculated: C, 61.72; H, 4.21; N, 13.49; S, 10.30; found: C, 61.59; H, 4.19; N, 13.54; S, 10.28. IR (KBr), ν (cm−1): 3079 (CH aromatic), 3045 (OH), 2982 (CH aliphatic), 1702 (C=O), 1599 (C=N), 688 (C–S). 1H NMR (DMSO-d 6) δ (ppm): 4.04 (s, 2H, CH2), 7.28–7.61 3-deazaneplanocin A mw (m, 10H, 10ArH), 12.97 (s, 1H, OH). 4-Carboxymethyl-5-[(4,5-diphenyl-4H-1,2,4-triazol-3-yl)sulfanyl]methyl-4H-1,2,4-triazole-3(2H)-thione

(9) Compound 9 was obtained using the same method as described earlier for derivatives 5a–i. That is, a mixture of thiosemicarbazide 4k (10 mmol) and 20 mL of 2 % Navitoclax aqueous solution

of sodium hydroxide was refluxed for 2 h. Then, the solution was neutralized with diluted hydrochloric acid and the formed precipitate was filtered and crystallized from ethanol. Yield: 97.2 %, mp: 157–159 °C (dec.). Analysis for C19H16N6O2S2 (424.50); calculated: C, 53.76; H, 3.80; N, 19.80; S, 15.11; found: C, 53.88; H, 3.81; N, 19.74; S, 15.47. IR (KBr), ν (cm−1): 3228 (NH), 3095 (OH), 3062 (CH aromatic), 2991 (CH aliphatic), 1713 (C=O), 1605 (C=N), 1504 (C–N), 1343 (C=S), 681 (C–S). 1H NMR (DMSO-d 6) δ (ppm): 4.42 (s, 2H, CH2), 4.78 (s, 2H, CH2), 7.27–7.56 (m, 10H, 10ArH), 13.80 (s, 1H, OH), 14.13 (brs, 1H, NH). 5-[(4,5-Diphenyl-4H-1,2,4-triazol-3-yl)sulfanyl]methyl-2,5-dihydro-4H-1,2,4-triazole-3(2H)-thione (10) Compound 10 was obtained using the same method as described earlier for derivatives 5a–i. That is, a mixture of thiosemicarbazide 4l (10 mmol) and 20 mL of 2 % aqueous solution of sodium hydroxide was refluxed

for 2 h. Then, the solution was neutralized with diluted hydrochloric acid and the formed precipitate was filtered and crystallized from ethanol. Yield: 78.9 %, mp: 210–212 °C (dec.). Analysis for C17H14N6S2 (366.46); calculated: C, 55.72; H, 3.85; N, 22.93; S, 17.50; found: C, 55.58; Bay 11-7085 H, 3.83; N, 23.01; S, 17.46. IR (KBr), ν (cm−1): 3256 (NH), 3079 (CH aromatic), 2956, 1461 (CH aliphatic), 1603 (C=N), 1510 (C–N), 1329 (C=S), 695 (C–S). 1H NMR (DMSO-d 6) δ (ppm): 4.04 (s, 2H, CH2), 7.29–7.92 (m, 10H, 10ArH), 13.33 (s, 1H, NH), 14.15 (brs, 1H, NH). [3-[(4,5-Diphenyl-4H-1,2,4-triazol-3-yl)sulfanyl]methyl-1-(pyrrolidin-1-ylmethyl)-5-thioxo-1,5-dihydro-4H-1,2,4-triazol-4-yl]acetic acid (11) To a solution of 10 mmol of compound 9 in ethanol, pyrrolidine (10 mmol) and formaldehyde (0.2 mL) were added. The mixture was stirred for 2 h at room temperature.

Immediately after elimination of extracellular bacteria by gentamicin treatment (0 h post gentamicin treatment), no statistically significant difference was observed in the counts of internalized wild-type or htrA mutant bacteria (Figure  3A), with 0.24 and 0.18% of the original inoculum recovered, respectively.

The counts of internalized bacteria recovered 5 h post gentamicin treatment decreased significantly to 0.08 and 0.025% of the original inoculum for the wild-type and the htrA mutant, respectively. This decrease in intracellular survival was significantly greater for the htrA mutant (~7 fold) Luminespib order compared to the wild-type strain (~3 fold) (Figure  3A). While no htrA mutants were detected at 24 h, ~1 × 103 CFU/ml of wild-type bacteria were recovered at this time point, STI571 clinical trial representing a ~300 fold reduction

compared with the 0 h time point. These data indicate that htrA is important for intra-amoebae survival in the 24 h time frame studied, but not for the uptake step. This suggests that pre-exposure to stress, via its transcriptional regulation on virulence-associated genes, may affect survival of intra-amoeba bacteria. Figure 3 Intracellular survival rates of C. jejuni cells within A. castellanii . Intracellular survival rates were determined by colony forming unit (CFU) counting at 0, 5, and 24 h post gentamicin treatment at 25°C in aerobic conditions. Panel A: comparison of wild-type (WT) and htrA mutant. Panel B: comparison of stressed and non-stressed wild-type bacteria. Carbohydrate Data are means and standard errors of three independent experiments. Statistically significant differences concern comparisons between control and treatment groups. (*) p < 0.05; (**) p < 0.01; nd, none detected. Uptake of stressed C. jejuni by A. castellanii and intracellular survival To examine the impact of pre-exposure to stressful environments on the degree of phagocytosis by amoebae

and on the intracellular survival of wild-type C. jejuni in amoebae, stressed and non-stressed C. jejuni cells were co-cultured with A. castellanii. Approximately 4.5 × 108 CFU/ml bacteria were subjected to either the stress or control treatments before interactions with amoeba. The survival data presented in Figure  3B were normalized to account for the number of bacteria that had survived exposure to the stress tested (or to the control treatment) before inoculation of the amoeba. Immediately after elimination of extra-amoeba bacterial cells by gentamicin treatment, approximately 0.18% of the original non-stressed bacterial inoculum was recovered as internalized bacteria, but only ~0.06 and 0.14% of the C. jejuni inoculum pre-exposed to low nutrient and osmotic stresses were recovered, respectively (Figure  3B). No statistically significant differences were obtained with C. jejuni pre-exposed to heat and oxidative stresses compared with non-stressed bacteria.