All reactions were conducted in 50 μL volume containing PCR buffer with 1.5 mM MgCl2, 0.2 mM dNTP, 0.5 μM each of primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) according to Edwards et al. (1989), 0.6 μL of dimethyl sulfoxide and 1.25 U of Taq polymerase (Qiagen TAQ PCR Core Kit). PCR was performed using a Mastercycler ep S gradient thermocycler (Eppendorf, Canada) learn more with the following conditions: 5 min at 94 °C, followed by 29 cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C, and finally one cycle of 7 min at 72 °C. PCR amplicons were

sequenced at the Genome Quebec Innovation Center (Montreal, Canada). Escherichia coli cells and sterile water were, respectively, used as positive and negative controls. Sequences were identified by blast nucleotide searches in the NCBI website, and the seven different sequences obtained were deposited in the EMBL database under accession numbers FN668006–FN668012. The phylogenetic tree was inferred using the maximum likelihood method based on the Tamura–Nei model in mega software with 1000 bootstrap replicates (Tamura et al., 2007). Three washed G. irregulare spores

isolated from soil were individually directly placed in a PCR tube, and the 16S rRNA gene was amplified using a nested-PCR protocol. A first round using pA and pH primers (Edwards et al., 1989) and a second round using primers 968-GC/1378 (Heuer et al., 1997) amplified approximately a 500-bp fragment corresponding to the hypervariable regions V6–V9. Bacterial biodiversity was assessed by running the amplicons through denaturing gradient gel electrophoresis (DGGE), as described C646 in vitro in Yergeau et al. (2007) with a 45–65% denaturant gradient using a DCode Universal Mutation Detection System (BioRad). Based on the approach described in St-Arnaud et al. (1995), two-compartment Petri dishes were prepared as described above, except that after solidification of the gel, sterile microscope coverslips were placed along

the central wall, and a further 3 mL of gellified sterile Diflunisal water was poured over the edge of coverslips to form a bridge helping the fungus to cross (Fig. 1). Plates received transformed carrot roots inoculated with G. irregulare in the compartment filled with M medium and the roots were regularly trimmed to avoid any crossing into the second compartment, where only the hyphae were allowed to grow. When hyphae grew over the coverslip, they were inoculated with various bacterial isolates from cultures grown in a liquid tryptic soy broth medium for 24 h. All bacterial cells were rinsed and the concentrations were adjusted to 106 CFU mL−1 with a sterile 0.9% NaCl solution before use. A 150-μL aliquot of each bacterial suspension was deposited directly on the top of the coverslip where hyphae were growing. Each bacterial isolate was replicated five times and the controls included E.

Although pain is multifactorial at cellular and molecular levels, it is widely accepted that neurotrophin (TrkA, p75NTR, Ret and GFRs), cannabinoid (CB1 and CB2), and thermo-transient receptor potential (TRPs; TRPV1, TRPA1 and TRPM8) receptors play a pivotal role. They form a threesome for which endocannabinoids appear to be a first line of defence against pain, while neurotrophins and thermoTRPs are Enzalutamide in vitro the major generators of painful signals. However, endocannabinoids may exhibit nociceptive activity while some neurotrophins may display

anti-nociception. Accordingly, a clear-cut knowledge of the modulation and context-dependent function of these signalling cascades, along with the molecular and dynamic details of their crosstalk, is critical for understanding and controlling pain transduction. Here, the recent progress in this fascinating topic, as well as the tantalizing questions that remain unanswered, will be discussed. Furthermore, we will underline the need for using a systems biology approach (referred to as systems pain) to uncover the dynamics and interplay

of these intricate signalling cascades, taking into consideration the molecular complexity and cellular heterogeneity of nociceptor populations. Nonetheless, the available information confirms that pharmacological modulation of this signalling triad is a highly valuable therapeutic strategy for effectively treating pain syndromes. “
“To advance our understanding of the biological basis of speech-in-noise perception, we investigated the GSI-IX price effects of background noise on both subcortical- and cortical-evoked responses, and the relationships between them, in normal hearing young adults. The addition of background noise modulated subcortical and cortical Erythromycin response morphology. In noise, subcortical responses were later, smaller in amplitude and demonstrated decreased neural precision in encoding the speech sound. Cortical responses were also delayed by noise, yet the amplitudes of the major peaks (N1, P2) were affected differently, with N1 increasing and P2 decreasing. Relationships between neural measures and speech-in-noise ability

were identified, with earlier subcortical responses, higher subcortical response fidelity and greater cortical N1 response magnitude all relating to better speech-in-noise perception. Furthermore, it was only with the addition of background noise that relationships between subcortical and cortical encoding of speech and the behavioral measures of speech in noise emerged. Results illustrate that human brainstem responses and N1 cortical response amplitude reflect coordinated processes with regards to the perception of speech in noise, thereby acting as a functional index of speech-in-noise perception. “
“Methamphetamine (METH) causes irreversible damage to brain cells leading to neurological and psychiatric abnormalities.

Although pain is multifactorial at cellular and molecular levels, it is widely accepted that neurotrophin (TrkA, p75NTR, Ret and GFRs), cannabinoid (CB1 and CB2), and thermo-transient receptor potential (TRPs; TRPV1, TRPA1 and TRPM8) receptors play a pivotal role. They form a threesome for which endocannabinoids appear to be a first line of defence against pain, while neurotrophins and thermoTRPs are Cyclopamine the major generators of painful signals. However, endocannabinoids may exhibit nociceptive activity while some neurotrophins may display

anti-nociception. Accordingly, a clear-cut knowledge of the modulation and context-dependent function of these signalling cascades, along with the molecular and dynamic details of their crosstalk, is critical for understanding and controlling pain transduction. Here, the recent progress in this fascinating topic, as well as the tantalizing questions that remain unanswered, will be discussed. Furthermore, we will underline the need for using a systems biology approach (referred to as systems pain) to uncover the dynamics and interplay

of these intricate signalling cascades, taking into consideration the molecular complexity and cellular heterogeneity of nociceptor populations. Nonetheless, the available information confirms that pharmacological modulation of this signalling triad is a highly valuable therapeutic strategy for effectively treating pain syndromes. “
“To advance our understanding of the biological basis of speech-in-noise perception, we investigated the buy MK-2206 effects of background noise on both subcortical- and cortical-evoked responses, and the relationships between them, in normal hearing young adults. The addition of background noise modulated subcortical and cortical OSBPL9 response morphology. In noise, subcortical responses were later, smaller in amplitude and demonstrated decreased neural precision in encoding the speech sound. Cortical responses were also delayed by noise, yet the amplitudes of the major peaks (N1, P2) were affected differently, with N1 increasing and P2 decreasing. Relationships between neural measures and speech-in-noise ability

were identified, with earlier subcortical responses, higher subcortical response fidelity and greater cortical N1 response magnitude all relating to better speech-in-noise perception. Furthermore, it was only with the addition of background noise that relationships between subcortical and cortical encoding of speech and the behavioral measures of speech in noise emerged. Results illustrate that human brainstem responses and N1 cortical response amplitude reflect coordinated processes with regards to the perception of speech in noise, thereby acting as a functional index of speech-in-noise perception. “
“Methamphetamine (METH) causes irreversible damage to brain cells leading to neurological and psychiatric abnormalities.

Contrary to previous results with roGFP, the optimized roGFP1_iE and roGFP1_iL constructs were not completely oxidized, and are therefore useful

sensors for monitoring the ER under conditions when it is even more oxidized. The development of methods for the visualization of disulfide bond formation and the analysis of redox conditions in different cell compartments of living cells has been on the rise for years. Because of the bright and visible fluorescence, variants of green fluorescent protein (GFP) represent attractive reporters for in vivo applications, as they allow noninvasive redox monitoring at the single-cell level. Redox-sensitive fluorescent proteins (roGFP, rxYFP) were produced by substitution of surface-exposed ZD1839 price cysteine residues of GFP, resulting in the formation of a disulfide bond without destroying the structure of the protein (Dooley et al., 2004; Ostergaard et al., 2004). The available redox-sensitive GFPs vary in their excitation and emission wavelength, and their

ratiometric Alectinib behavior. The oxidation state of these GFP-based redox sensors is specifically sensitive to the redox pair of reduced and oxidized glutathione (GSH/GSSG), but not to thioredoxin (Ostergaard et al., 2001; Meyer et al., 2007). Glutathione is considered to be the major thiol/disulfide redox buffer of the cells and participates in detoxification, protection from oxidative damage and formation of native disulfide bonds (recently reviewed by Meyer et al., 2007). Usually, the concentration of glutathione in the cell is rather high

(5–10 mM), but the ratio between GSH and GSSG differs among cellular compartments: while the cytosol exhibits a GSH : GSSG ratio of up to 100 : 1, MYO10 the endoplasmic reticulum (ER) is more oxidizing, with a ratio of 10 : 1 (Hwang et al., 1992). However, the accurate quantification of glutathione ratios within different organelles has serious limitations; thus, the optimization of redox-sensitive GFPs as biosensors that can be targeted to different cellular compartments gains even more importance (Bjornberg et al., 2006). Studies of recent years have shown that these indicators function efficiently within reducing compartments such as cytosol and the mitochondria (Hanson et al., 2004; Schwarzer et al., 2007), but show deficiencies when used in more oxidizing environments such as the ER. Probably the high thermodynamic stability of the disulfide bond introduced is responsible for this problem, which has made a quantitative analysis of more oxidizing compartments impossible so far (Lohman & Remington, 2008). The ER provides an oxidizing environment that is highly optimized for the folding of proteins. The formation of disulfide bonds in proteins is attained through the oxidative protein folding machinery, including protein disulfide isomerase Pdi1 and its oxido-reductase Ero1, in which the enzymic glutathione pathway is also involved (reviewed in Tu & Weissman, 2004).

The discussion should include the following: The decision to start ART is the patient’s

choice and must not be due to pressure from partners or others. ART lowers, rather than eliminates, the risk of transmission; other prevention strategies, including male and female condoms continue to be recommended to address concerns of any residual risk of transmission. For a patient with a CD4 cell count >350 cells/μL, it is uncertain whether any benefits of immediate treatment to their own health will be outweighed by any harm. Condoms, both male and female, continue to be recommended as protection from other sexually transmitted OSI 744 infections and unplanned pregnancy. There are risks associated with interrupting ART, and once started, it should generally be continued indefinitely. The evidence that ART lowers the risk of transmission mainly relates to vaginal sex. Although ART is highly likely to reduce the risk of transmission for anal sex, the residual risk could be higher than that seen in studies for vaginal sex. There are currently few data to inform this. High and consistent adherence Osimertinib supplier to ART is required to maintain viral suppression and minimize transmission risk. Taking ART does not result in immediate complete viral suppression; it usually takes several

months to achieve an undetectable VL in blood. The use of ART to reduce transmission risk is a particularly important consideration in serodiscordant heterosexual couples wishing to conceive and it is recommended that the HIV-positive partner be on fully suppressive

ART. The potential effect of HIV treatment to reduce the risk of onward sexual transmission should be discussed with all patients as a part of safer sex messages in general. The discussion should include the HIV status of their partner(s) and whether ART is indicated for their own health. This discussion Arachidonate 15-lipoxygenase should make clear that there is good evidence from one RCT (HPTN 052) [1] that ART treatment can markedly reduce (by 96%) the risk of transmission to HIV-negative partners. This is supported by the secondary outcomes of another trial [2] that also found a marked reduction in transmission from partners taking ART (by 92%). It is important to note that only 3% of the couples in HPTN 052 were men who have sex with men and the Partners in Prevention study was conducted entirely in heterosexual couples. The evidence base thus relates mainly to the risk of transmission for vaginal sex in heterosexual couples. It seems likely that a reduction in risk will also be seen for anal sex, but this is the subject of ongoing studies. Before these randomized controlled studies, the evidence base for treatment to reduce transmission was based on a number of cohort studies that found that transmission between heterosexual couples where the HIV-positive partner had an undetectable VL on treatment was very rare or did not occur [3-7].

In summary, we recommend that when EFV is used with rifampicin, and in patients over 60 kg, Sotrastaurin price the EFV dose is increased to 800 mg daily. Standard doses of EFV are recommended if the patient weighs <60 kg. We suggest that TDM be performed at about the week of starting EFV if side effects occur and the dose adjusted accordingly. NVP taken with TB treatment is complicated by pharmacokinetic

interactions and by overlapping toxicities, especially skin rash and hepatitis. One study showed that patients co-infected with HIV and TB who initiated NVP-based ART during TB treatment had a nearly twofold higher risk of having a detectable HIV VL after 6 months compared with those taking NVP who did not have TB. However, those patients who were established on NVP at the time of initiation of TB treatment BKM120 mouse did not have a higher risk of HIV virological failure [11]. Using a higher maintenance dose of NVP (300 mg bd) to overcome drug interactions has been associated with higher rates of hepatotoxicity [15]. In one randomized trial comparing NVP 200 mg twice daily

at initiation with EFV 600 mg once daily among patients with TB and HIV and CD4 cell counts <250 cells/μL, non-inferiority of NVP was not demonstrated compared with EFV [16]. When co-administered with rifampicin, concentrations of standard-dose PIs are decreased below therapeutic targets and cannot, therefore be recommended [17-19]. Changing the dosing of PI/r has resulted in unacceptable rates of hepatotoxicity [20-22]. Rifabutin has little effect on the concentrations of PI/r but rifabutin concentrations are increased when the drug is taken together with PIs. Current recommendations are to give rifabutin at a dose of 150 mg

thrice weekly to adults taking PI/r. Progesterone Some data suggest that 150 mg once daily can be given to reduce the theoretical risk of rifamycin resistance due to subtherapeutic rifabutin concentrations, but this strategy may be associated with increased side effects [23-30]. There are few clinical data to support the use of newer NNRTIs, INIs and CCR5 receptor antagonists with rifampicin or rifabutin. We recommend that physicians review pharmacokinetic and other data summarized in the current BHIVA guidelines for treatment of TB/HIV coinfection [1]. The following guidance provides a brief summary of the key statements and recommendations regarding prescribing ART in patients with HIV/hepatitis B and C coinfection. It is based on the BHIVA guidelines for the management of coinfection with HIV-1 and hepatitis B or C virus [1], which should be consulted for further information and to the BHIVA website for latest updates (http://www.bhiva.org/publishedandapproved.aspx).

There were several important limitations in this study. Awareness of PREP among HIM participants was not ascertained, and thus it was not possible to assess the relationship between PREP knowledge and willingness to participate in PREP trials. The question on willingness to participate in trials using ARVs to prevent HIV infection potentially included men’s attitudes to PREP and/or NPEP trials. Caspase inhibitor However, as the intervention is

the same (oral antiviral therapy), it is feasible that men’s attitudes towards participation in PREP and NPEP trials would be similar. This study demonstrates that Australian gay men have had little experience with PREP use and that most are unaware of rectal microbicides. About half would be willing to consider participation in a trial of ARV therapy as prevention, and about one-quarter would consider participation in a trial of rectal microbicides. With its concentrated HIV epidemic, Australia is a potential site to trial such biomedical HIV prevention technologies. Extensive community education on these technologies,

in particular rectal microbicides, and any potential role they might play in HIV prevention, would be required before PREP or rectal microbicides could be trialled in populations of gay Australian men. The authors thank all the participants, the dedicated HIM study team and the participating doctors and clinics. The National Centre in HIV Epidemiology and Clinical Research and the National Centre in HIV Social Research are funded by the Australian Government Department of Health Selleck Lumacaftor and Ageing. The Health in Men Cohort study was funded mafosfamide by the National Institutes of Health, a component of the US Department of Health and Human Services (NIH/NIAID/DAIDS: HVDDT Award N01-AI-05395), the National Health and Medical Research Council in Australia (Project grant no. 400944), the Australian Government Department of Health and Ageing (Canberra) and the New South Wales Health Department (Sydney). IMP is supported by a National

Health and Medical Research Council (NHMRC) Public Health Postgraduate Scholarship. The authors have no conflict of interest. “
“Hepatitis C virus (HCV) has emerged as an important health problem in the era of effective HIV treatment. However, very few data exist on the health status and disease burden of HIV/HCV-coinfected Canadians. HIV/HCV-coinfected patients were enrolled prospectively in a multicentre cohort from 16 centres across Canada between 2003 and 2010 and followed every 6 months. We determined rates of a first liver fibrosis or endstage liver disease (ESLD) event and all-cause mortality since cohort enrolment and calculated standardized mortality ratios compared with the general Canadian population. A total of 955 participants were enrolled in the study and followed for a median of 1.4 (interquartile range 0.5–2.3) years. Most were male (73%) with a median age of 44.

51  Limketkai BN, Mehta SH, Sutcliffe CG et al. Relationship of liver disease stage and antiviral therapy with liver-related events and death in adults coinfected with HIV/HCV. JAMA 2012; 308: 370–378. 52  Jain MK, Seremba E, Bhore R et al. Change in fibrosis score as a predictor of mortality among HIV-infected patients

with viral hepatitis. AIDS Patient Care STDS 2012; 26: 73–80. 53  Cozzi Lepri A, Prosperi M, LoCaputo S et al. Fib4 is an independent predictor Baf-A1 clinical trial of serious liver disease among HIV-infected patients with or without HBV/HCV co-infection in the Icona foundation study. Infection 2010; 38: 73–74. 54  Vu TM, Sutcliff C, Mehta S et al. Baseline liver stiffness measured by transient elastography is independently associated with risk of end-stage liver disease and death among HIV/HCV co-infected adults. J Hepatol 2011; 54(Suppl 1): S470. 55  Martinez SM, Crespo G, Navasa M, Forns X. Noninvasive assessment of liver fibrosis. Hepatology 2011; 53: 325–335.

56  Lin ZH, Xin YN, Dong QJ et al. Performance of the aspartate aminotransferase-to-platelet ratio index for the staging of hepatitis C-related fibrosis: an updated meta-analysis. Hepatology 2011; 53: buy LDK378 726–736. 57  Sebastiani G, Castera L, Halfon P et al. The impact of liver disease aetiology and the stages of hepatic fibrosis on the performance of non-invasive fibrosis biomarkers: an international study of 2411 cases. Aliment Pharmacol Ther 2011; 34: 1202–1216. 58  Resino S, Asensio C, Bellón JM et al. Diagnostic accuracy of the APRI, FIB-4, and the Forns index for predicting liver fibrosis in HIV/HCV-coinfected patients: a validation study. J Infect 2011; 63: 402–405. 59  Boursier J, Salmon D, Winnock P et al. Non-invasive diagnosis of liver fibrosis by fibroscan, blood tests, and their combination in HIV-HCV co-infected patients. buy C59 J Hepatol 2012; 56(Suppl 2): S408. 60  Peters

M, Bacchetti R, Boylan A et al. Utility of enhanced liver fibrosis (ELF) marker as a predictor of mortality in HIV/HCV co-infected women from the Women’s Interagency HIV Study (WIHS). 6th IAS Conference on HIV Pathogenesis, Treatment and Prevention. Rome, Italy. July 2011 [Abstract WEABO103]. 61  Sanchez-Conde M, Miralles P, Bellon JM et al. Use of transient elastography (FibroScan) for the noninvasive assessment of portal hypertension in HIV/HCV-coinfected patients. J Viral Hepat 2011; 18: 685–691. 62  Friedrich-Rust M, Ong MF, Martens S et al. Performance of transient elastography for the staging of liver fibrosis; a meta-analysis. Gastroenterology 2008; 134: 960–974. 63  Castera L, Vergniol J, Foucher J et al. Prospective comparison of transient elastography, Fibrotest, APRI, and liver biopsy for the assessment of fibrosis in chronic hepatitis C. Gastroenterology 2005; 128: 343–350. 64  Stebbing J, Farouk L, Panos G et al. A meta-analysis of transient elastography for the detection of hepatic fibrosis.

Although these methods provide only an estimate of putative input synapse distributions, the data indicate that inhibitory

and excitatory synapses were located preferentially on different dendritic domains of MN5 and, thus, computed mostly separately. Most putative inhibitory inputs were close to spike ICG-001 in vitro initiation, which was consistent with sharp inhibition, as predicted previously based on recordings of motoneuron firing patterns during flight. By contrast, highest densities of putative excitatory inputs at more distant dendritic regions were consistent with the prediction that, in response to different power demands during flight, tonic excitatory drive to flight motoneuron dendrites must be smoothly translated into different tonic firing frequencies. “
“Serotonin (5-HT) plays a critical role in locomotor this website pattern generation by modulating the rhythm and the coordinations. Pet-1, a transcription factor selectively expressed in the raphe nuclei, controls the differentiation of 5-HT neurons. Surprisingly, inactivation

of Pet-1 (Pet-1−/− mice) that causes a 70% reduction in the number of 5-HT-positive neurons in the raphe does not impair locomotion in adult mice. The goal of the present study was to investigate the operation of the locomotor central pattern generator (CPG) in neonatal Pet-1−/− mice. We first confirmed, by means of immunohistochemistry, that there is a marked reduction of 5-HT innervation in the lumbar spinal cord of Pet-1−/− mice. Fictive locomotion was induced in the in vitro neonatal mouse spinal cord preparation by bath application of Cytidine deaminase N-methyl-d,l-Aspartate (NMA) alone or together with dopamine and 5-HT. A locomotor pattern characterized by left–right and flexor–extensor alternations was observed in both conditions. Increasing the concentration of 5-HT from 0.5 to 5 μm impaired the pattern in Pet-1−/− mice. We tested the role of endogenous 5-HT in the NMA-induced fictive locomotion.

Application of 5-HT2 or 5-HT7 receptor antagonists affected the NMA-induced fictive locomotion in both heterozygous and homozygous mice although the effects were weaker in the latter strain. This may be, at least partly, explained by the reduced expression of 5-HT2AR as observed by means of immunohistochemistry. These results suggest that compensatory mechanisms take place in Pet-1−/− mice that make locomotion less dependent upon 5-HT. “
“Midbrain dopaminergic neurons in the substantia nigra, pars compacta and ventral tegmental area are critically important in many physiological functions. These neurons exhibit firing patterns that include tonic slow pacemaking, irregular firing and bursting, and the amount of dopamine that is present in the synaptic cleft is much increased during bursting.

parahaemolyticus vibrioferrin utilization. Vibrio parahaemolyticus strains, and Escherichia coli strain and plasmids used in this study are listed in Table 1, and Table S1, respectively. Vibrio parahaemolyticus VPD5, which carries a deletion in pvsB that results in no VF production, was used

as a parental strain for the construction of various mutants to avoid any effects of VF produced by the wild-type strain. Escherichia coli β2155 (Demarre et al., 2005), a diaminopimelic selleck kinase inhibitor acid (DAP) auxotroph, was grown in Luria–Bertani (LB) medium containing 0.5% NaCl and 0.5 mM DAP. Vibrio parahaemolyticus was routinely cultured in LB medium containing 3.0% NaCl (+Fe medium). Appropriate antibiotics were added to the medium at the following concentrations: 10 μg mL−1 chloramphenicol, and 15 μg mL−1 tetracycline. When required,

V. parahaemolyticus was grown in LB medium containing 3.0% NaCl supplemented with 25 μM ethylenediamine di-o-hydroxyphenylacetic acid (EDDA; Sigma, St. Louis, MO) (−Fe medium) to impose iron limitation (Miles & Khimji, 1975). The genomic sequence information of V. parahaemolyticus RIMD2210633 (Makino et al., 2003) was obtained from the Genome Information Research Center (GIRC) at Osaka University (http://genome.bio.titech.ac.jp/bacteria/vpara/). A homology search was carried out using the blast program on GIRC or National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/) (Altschul et al., 1997). The V. parahaemolyticus cultures grown overnight in the +Fe medium were inoculated LBH589 Amisulpride into the +Fe and −Fe media at an optimal density of 0.005 at 600 nm (OD600 nm). When required, the −Fe medium was supplemented with VF (Yamamoto et al., 1994) at a final concentration of 20 μM (−Fe + VF medium). The cultures were then shaken at 70 rpm at 37 °C, and the OD600 nm was measured every 3 h for 24 h with a biophotorecorder TVS062CA

(Advantec, Tokyo, Japan). Although it was reported that EDDA is a strong chelator of ferric iron and the association constant of ferric EDDA (c. 1034) (Miles & Khimji, 1975) is higher than that of ferric VF (c. 1023) (Amin et al., 2009), growth of VF-nonproducer mutant VPD5 (i.e. ∆pvsB) repressed in the −Fe medium was restored in the –Fe + VF medium (Fig. 2). This indicates that a very small amount of ferric VF required for the growth of V. parahaemolyticus could be supplied successively by equilibrium, although almost all ferric iron would be ferric EDDA in the −Fe + VF medium. Thus, the medium prepared was successfully used to estimate growth promotion of the mutants by VF. The primers used to construct the gene-deletion fragments and confirm gene deletions in various mutants are listed in Table S2. PCR amplicons with the respective deletions in the V.