, 2004;

Stott & Kirik, 2006; Rahim et al., 2009, 2011). Germline genetic manipulation avoids the complications of surgery, but often yields unreliable mosaicism. Random integration-site effects result in variable density, cellular specificity, and regional distribution of transgene expression that made the Thy1-XFP series so useful for imaging, but required screening many lines to identify a few with patterns appropriate for study (Feng et al., 2000). Better control of mosaicism can be obtained using sparsely expressing Cre lines to direct lox-mediated recombination (Guo et al., 2002; Chakravarthy et al., 2008; Rotolo et al., 2008; Young et al., 2008), or more recently, recombination-mediated mosaic analysis with double markers (Zong et al., 2005) and mosaic mutant analysis with spatial and temporal

control of recombination (Lao et al., 2012). However, both of these approaches require the convergence of multiple find more independently assorting alleles in a small fraction of the offspring, AZD1208 cost are limited by the specificity of existing Cre lines and, in the case of mosaic analysis with double markers, may also necessitate construction of a modified locus for each gene to be studied (Zong et al., 2005; Espinosa et al., 2009; Hippenmeyer et al., 2010). An ideal approach would be easy to use, produce early-onset, long-lasting expression, and permit widespread genetic manipulation throughout the brain. Here we describe a simple technique to achieve both titratable genetic mosaicism and sparse fluorescent labeling by neonatal intraventricular injection of genetically engineered adeno-associated virus (AAV). The technique was initially developed by John Wolfe and colleagues to create brain-specific transgenic not mice that avoided problems associated with the developmental expression of ectopic proteins (Passini & Wolfe, 2001; Passini et al., 2003). Unlike germline transgenesis, random transduction by AAV produces a mosaic pattern of expression. At one extreme, injections can be tailored for sparse expression suited to the study of cell-intrinsic mechanisms, and at the other provide

dense expression designed for cell-extrinsic studies. Dual transduction of the same or non-overlapping populations can be attained by co-injection of multiple viruses encoding distinct genetic elements. Most importantly, neonatal AAV transduction targets neuronal populations throughout the brain, providing an easy way to manipulate regions that have been intractable by past methods. Four different inserts were cloned into the adeno-associated viral plasmid (pAAV) expression plasmid for these experiments (Table 1). The first of these constructs encoded the enhanced yellow fluorescent protein (YFP) and the tetracycline transactivator (tTA) separated by the Thosea asigna virus 2A sequence (GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA) (Trichas et al., 2008).